CATDOLL : CATDOLL: A red tide occurred in Hokkaido, Japan, killing nearly 90% of sea urchins. How will the carcasses of the sea urchins be handled?

A red tide occurred in Hokkaido, Japan, killing nearly 90% of sea urchins. How will the sea urchin carcasses be handled?

A red tide occurred in Hokkaido, Japan, killing nearly 90% of sea urchins. The sea urchin carcasses must be salvaged and disposed of in a timely manner, otherwise pollution will occur.

1. A red tide occurred in Hokkaido, Japan, and most sea urchins died. It may be impossible to catch sea urchins in the future.

Red tide is a very scary phenomenon. The rapid growth of mayflies in the sea has formed a red tide phenomenon at sea. The sea water has turned red or other colors. Because the sea surface is affected by the red tide phenomenon, it causes a lack of oxygen, which directly leads to the death of sea urchins and other seafood. According to relevant experts, because of the red tide in Hokkaido, Japan, most sea urchins died, and sea urchins may not be caught in the future. Sea urchins are a seafood with high nutritional value. The Japanese like to eat them very much. However, the red tide has caused the death of a large number of sea urchins, which is also a loss for Japan.

2. Dispose of the carcasses of sea urchins promptly

Because of the red tide in Hokkaido, Japan, most sea urchins died of lack of oxygen. The bodies of these sea urchins must be handled in time. Because the bodies of these sea urchins are poisonous, they must be salvaged and handled in time. Prevent the bodies of sea urchins from polluting other seafood in the sea area. Along with these sea urchins, many salmon are also affected. These are all caused by the red tide. The Japanese have a great demand for salmon, so the economic losses caused by this red tide cannot be underestimated. If there are no sea urchins to catch in the next five years, it will have a great impact on those gourmets, and they will not be able to eat these delicacies.

3. Causes of red tide

Some netizens said that the Japanese should find out the cause of the red tide phenomenon themselves. They discharged nuclear contaminated waste into the sea, which resulted in the reproduction of a large number of mayflies. The increase in their number led to the red tide phenomenon. The oxygen provided to sea urchins, salmon and other fish became less and less, and finally led to the death of a large number of sea urchins and salmon. How important is it to protect the environment? We must not discharge pollutants into the sea.

A red tide occurred in Hokkaido, Japan, killing nearly 90% of sea urchins. How will the sea urchin carcasses be handled?

1. A red tide occurred in Hokkaido, Japan, and nearly 90% of sea urchins died. What happened?

A very serious red tide phenomenon has occurred in Hokkaido, Japan. As one of the largest fishing grounds in the world, Hokkaido has suffered heavy losses due to this red tide. More than ninety percent of the sea urchins farmed by local fishermen have died. According to the fishermen, these sea urchins will break if you squeeze them with your hands. This is a huge economic loss for the fishermen who rely on farming seafood for a living. The waters of the entire Hokkaido region are filled with dead sea urchins all over the beaches. The local fishermen may not have any seafood to catch for a long time in the future.

2. What will happen to the carcasses of these sea urchins?

These dead sea urchins have all turned into empty shells, covering the beaches of the entire Hokkaido area. It is very difficult to deal with these empty shells of sea urchins, so local people can only let the empty shells of sea urchins continue to remain on the beach. Some fishermen pick up these empty shells of sea urchins and use them as feed to plant flowers and plants, but the vast majority of sea urchins can only be left on the beach after death.

3. How can we avoid this phenomenon?

The reason why Japan is facing such a serious red tide crisis this time is that the Japanese usually discharge some domestic sewage and industrial sewage directly into the ocean, which is bound to have a great impact on the water quality of the ocean. After these sewage enters the ocean, the seawater will appear eutrophic algae, and organisms will reproduce wildly in such a eutrophic environment, and red tides will appear. Algae will be responsible for the surface of some seafood such as sea urchins. These seafood cannot breathe and will naturally die. So this is a crisis brought by the Japanese themselves. To avoid this phenomenon, they can only do it by themselves and stop discharging various harmful wastewaters into the sea.

The carcasses of sea urchins need to be salvaged and disposed of in a timely manner. If left unattended, the carcasses will rot and cause huge water pollution, damaging the ecological environment of the waters near Hokkaido.

Because sea urchins are poisonous, it is best to clean them up and not let them float on the sea. However, too many sea urchins died this time and only a few were picked up by fishermen and taken home, while the rest continued to float on the sea.

What is the recall test?

What is the recall test?

The stimulation test is mainly used to check and measure the responsiveness of the airways, and is one of the main indicators for detecting lung function. Currently, inhaled stimulants are commonly used, such as methacholine and histamine drugs, as well as other allergens, as well as adenosine monophosphate, mannitol, hypertonic saline, and some physical stimulation factors, such as exercise, inhalation of cold air, etc. as stimulants. Usually, after these stimulants enter the human airway, it is determined whether there is a decrease in lung function. It can be used to diagnose diseases such as bronchial asthma and chronic obstructive pulmonary disease, and it can clarify the condition and make corresponding treatment and care plans in time.

Isolation and identification of the pathogen causing black mouth disease in sea urchin

Liu Yansong, Zhang Weijie, Wang Zhong, Yin Weijun, Ou Fanjiang, Tian Wenzhuo, Liu Lei, Chang Yaqing*

(Key Laboratory of Northern Marine Aquaculture, Ministry of Agriculture and Rural Affairs, Dalian Ocean University, Dalian, Liaoning 116023)

Abstract: In order to identify the pathogen of black mouth disease in Strongylocentrotus intermedius, a dominant bacterium (denoted as D1) was isolated from the coelomic fluid of sea urchins with black mouth disease. After the pathogenicity was determined by artificial induction test, the pathogen was observed by electron microscopy, Gram staining, physiological and biochemical identification and 16S rRNA sequence comparison to identify its taxonomic status. The sensitivity of D1 strain to 30 antibiotics was also determined. The results showed that the symptoms of sea urchins infected with D1 strain were the same as those of sea urchins infected with blackmouth disease in natural conditions, and the same strain was isolated from the coelomic fluid of infected sea urchins. The length and width of D1 strain were (2.10±0.31)μm×(0.68±0.08)μm, and it was a Gram-negative bacterium. The results of 16S rRNA sequence alignment showed that the consistency of D1 strain with Vibrio echinoideorum was as high as 99.04%. The results of biochemical identification showed that D1 strain was positive for sucrose, 6% NaCl peptone water and oxidase. Based on the results of physiological and biochemical tests and 16S rRNA molecular biological identification, the pathogen was determined to be Vibrio echinoideorum. The drug sensitivity test showed that the strain was sensitive to 16 antimicrobial drugs including ofloxacin, polymyxin B, co-trimoxazole, ampicillin and carbenicillin, and resistant to 11 antimicrobial drugs including midecamycin and gentamicin. Studies have shown that the pathogen of black mouth disease in sea urchins is Vibrio echinoderma, and this strain is insensitive to some antibiotics and has a certain degree of drug resistance.

Keywords: Sea urchin (Sea Urchin) intermedia; black mouth disease; pathogen identification

Strongylocentrotus intermedius is a high-quality sea urchin species with the characteristics of fast growth, bright gonad color, plump texture and sweet taste. Strongylocentrotus intermedius is native to the northern coast of Japan and the coast of parts of the Russian Far East. Since China introduced this species from Japan in 1989, it has carried out a series of studies on its biology, ecology, artificial seedling and genetic breeding[1-2], and also started artificial aquaculture production. At present, Strongylocentrotus intermedius has become one of China's important aquaculture species of marine delicacies[2]. In recent years, sea urchins have gradually been recognized by Chinese consumers, and the scale of their aquaculture has continued to expand. However, bacterial diseases such as black mouth disease[3], red spot disease[4-5] and lesion syndrome[6] have also begun to frequently break out in aquaculture production, seriously restricting the healthy development of the sea urchin aquaculture industry.

Black mouth disease is one of the most serious diseases in the culture of intermediate sea urchins. The low temperature period between spring and summer is the peak period for frequent outbreaks of black mouth disease, and the pathogen of black mouth disease is highly pathogenic to damaged sea urchins[7]. The main characteristic of diseased sea urchins is the black color of the perioral membrane. As the disease gradually worsens, they cannot attach and feed normally, and their spines gradually fall off until they die[3]. Black mouth disease is highly contagious and has a high mortality rate. It is very harmful in the culture of intermediate sea urchins. Therefore, the isolation and identification of the pathogen of black mouth disease and the research on the pathogenic characteristics of the pathogen are of great significance for the effective prevention and control of black mouth disease in intermediate sea urchins. At present, the identification of the pathogen of black mouth disease in intermediate sea urchins is still controversial. Takeuchi et al. [8] isolated a strain from an intermediate sea urchin with black mouth disease. Based on the biochemical characteristics, DNA-DNA homology and serological analysis of the pathogen, they proved that the pathogen was Vibrio; while Li Taiwu et al. [3] identified the pathogen of the intermediate sea urchin black mouth disease as Bacillus firmus based on the morphological characteristics and biochemical characteristics of the pathogen. The reason may be that there are many pathogens of black mouth disease, resulting in different types of pathogens isolated, or it may be due to different experimental methods and identification methods, resulting in different results. In view of the continuous advancement of bacterial identification technology, it is necessary to re-identify the pathogen of black mouth disease. In this study, the pathogen of the intermediate sea urchin with black mouth disease was isolated and purified, and the pathogen was identified by a series of methods such as electron microscopy, Gram staining, physiological and biochemical identification and 16S rRNA sequence comparison, in order to provide a scientific reference for the prevention and treatment of sea urchin black mouth disease.

1 Materials and methods

1.1 Materials

The diseased and healthy sea urchins used in the experiment were taken from the same batch of artificial breeding groups in the Key Laboratory of Northern Marine Aquaculture, Ministry of Agriculture and Rural Affairs, Dalian Ocean University, and individuals with typical symptoms of black mouth disease were selected as experimental materials for pathogen isolation.

Antimicrobial drug susceptibility paper was purchased from Hangzhou Microbiological Reagent Co., Ltd.; bacterial micro-identification tubes were purchased from Haibo Biotechnology Co., Ltd.; 2216E culture medium, sterile inoculation loop and PBS reagent were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

1.2 Methods

1.2.1 Isolation and purification of pathogens Under sterile conditions, sea urchins with typical symptoms of black mouth disease were dissected, and the coelomic fluid was aspirated and streaked on 2216E solid culture medium. After constant temperature culture at 16 °C for 12 h, the morphology, size and color of the colonies were observed and compared, and the dominant colonies were selected for purification and culture. The bacterial solution was mixed with 80% glycerol in a volume ratio of 1:1 and stored at -80 °C for later use. The isolated bacteria were numbered D1.

1.2.2 Artificial relapse test The artificial relapse infection test was conducted by immersion method. 200 healthy and symptom-free sea urchins were randomly selected and placed in 4 10 L sterilized water tanks. The test was started after 3 days of temporary culture. After piercing the sea urchin perioral membrane with a 1 mL sterile syringe needle to cause damage, 10 μL of D1 bacterial solution with a concentration of 108 cfu/mL was added to the water tank. The final immersion stress concentration was 102 cfu/mL. The control group only used needles to damage the sea urchins and cultured them in sterile seawater. The water temperature was maintained at (17±1)℃ during the experiment. The symptoms and deaths of the experimental sea urchins were observed for 7 consecutive days and recorded.

1.2.3 Morphological observation of pathogens The purified pathogens were spread on a glass slide, fixed by flame, then washed with water after adding crystal violet stain for 1 min, iodine solution for 1 min, decolorizing solution for 1 min, and re-staining solution for 30 min, and then dried for microscopic examination.

10 mL of D1 bacterial solution with a concentration of 109 cfu/mL was centrifuged (3 000 g), the supernatant was removed, and 5 mL of 0.1 mol/L PBS was added for washing. After washing three times, 5 mL of 2.5% glutaraldehyde was added for fixation for 3 h, washed twice with PBS, washed twice with pure water, and then dehydrated with gradient ethanol solutions with volume fractions of 30%, 50%, 70%, 80%, 90% and 100%. Finally, the treated sample was dropped on a 1 cm×1 cm shell and placed in an oven for drying. After the sample was fully dried, it was observed by scanning electron microscopy.

1.2.4 Biochemical characteristics of pathogens The isolate D1 was inoculated on 2216E solid culture medium and cultured at 16 °C for 24 h. A suitable number of single colonies were picked with a sterile inoculation loop and inoculated into bacterial micro-identification tubes, which were sealed with sterile sealing film and cultured at 37 °C.

1.2.5 Molecular biological identification of pathogens Pick a freshly cultured single colony into 2216E liquid medium, culture it at 16 ℃ for 12 h, and then take 1 μL and dilute it 5 times as a template. Use universal primers (primer sequences are 8F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT) to amplify the full length of the 16S rRNA gene. Reaction system (50 μL in total): 2 μL each of forward and reverse primers, 1 μL DNA template, 0.4 μL rTaq, 4 μL dNTP Mixture, 5 μL 10×PCR Buffer, and make up to 50 μL with sterile water. Reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 43.6 °C for 30 s, extension at 72 °C for 1 min, for a total of 35 cycles; and finally extension at 72 °C for 10 min. The unpurified PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The returned 16S rRNA gene amplified sequences of the D1 strain were spliced ​​using MEGA X software, and multiple sequences were aligned in the Ezbio Cloud database after obtaining the full length. Several common pathogenic Vibrio species with high similarity to the 16S rRNA gene sequences of the D1 strain in the EzBio Cloud database were aligned using MEGA X software, and the phylogenetic tree was constructed using the neighbor-joining method (NJ), and the confidence test was performed using a bootstrap analysis (bootstrap) with 1 000 bootstrap data sets.

1.2.6 Drug sensitivity test The drug sensitivity test of pathogen D1 was carried out by using drug sensitivity paper diffusion method. 200 μL of fresh bacterial solution was spread on 2216E solid culture medium, and the drug sensitivity paper was attached to the surface of the culture medium with fresh bacterial solution using sterile tweezers. The culture was kept at 16 ℃ for 24 h. According to the Interpretation Standard of Antibacterial Range of Drug Sensitivity Test Paper Method provided by Hangzhou Microbiological Reagent Co., Ltd., the drug sensitivity of the pathogen strain was determined by measuring the diameter of the inhibition zone.

2 Results and Analysis

2.1 Isolation and purification of pathogens

As can be seen from Figure 1, after the dominant pathogen D1 extracted from the diseased sea urchin was cultured on 2216E medium for 12 h (16 ℃), the colonies were round, milky white and opaque.

2.2 Artificial Reflex Test

Artificial induction test found that within 48 hours of infection, the sea urchins showed symptoms such as blackening of the perioral membrane, retraction of the tube feet, loss of attachment ability, and weakened motility (Figure 2), which were the same as the symptoms of naturally occurring sea urchins. As can be seen from Table 1, the infected sea urchins began to die after 48 hours, and the average mortality rate of the three groups on the 8th day was 30.67%±1.15%; the sea urchins in the control group were temporarily placed in sterile seawater after being damaged, and no symptoms occurred. At the same time, the dominant bacteria were isolated again from the artificially infected diseased sea urchins, and the secondary isolated strains were used to infect healthy sea urchins. The symptoms of sea urchin black mouth disease were the same as those of natural disease, and the 16S rRNA sequence comparison results were consistent with strain D1. This shows that strain D1 is the pathogen of the black mouth disease of the intermediate ball sea urchin.

Hello, in response to your question, the infectivity test is actually an experimental method that uses tissue sectioning and immunohistochemistry technology to perform histopathological sections on the liver, spleen, kidney and other tissues of infected animals, and performs HE staining and immunohistochemical analysis.

front page

Love Dream Builder

Get Sohu membership

Watch high-definition World Cup sports events online for free!

advertise

Experiment on a new model of integrated rice-crab farming

Sister Zhang talks about human feelings

07:10

+Subscribe

Experiment on a new model of integrated rice-crab farming

Experiment on a new model of integrated rice-crab farming

_Li Xiaojin et al.

Crab integrated farming occupies an important position in the integrated farming of rice and fish in Liaoning Province, and is a dominant fishery industry in Liaoning Province. According to the Liaoning Provincial Fisheries Statistical Yearbook, the integrated farming area of ​​rice and fish in Liaoning Province in 2020 was 1 million mu, and the output of river crabs was 55,000 tons. In order to ensure food security and promote agricultural income growth, and implement the "Several Opinions on Accelerating the Green Development of Aquaculture" issued by the Ministry of Agriculture and Rural Affairs and other ten ministries, the Liaoning Provincial Department of Agriculture and Rural Affairs has formulated the "Guiding Opinions on Accelerating the Development of Integrated Farming of Rice and Fisheries in Liaoning Province", and set aside special funds every year to support the advancement of the industry. It is planned that by the end of the "14th Five-Year Plan", the integrated farming area of ​​rice and fish in Liaoning Province will develop to 1.5 million mu. To ensure the realization of this goal, the team conducted exploratory research on the problem of low comparative benefits of integrated farming of rice and crabs in Liaoning Province, looking for local methods to promote the development of integrated farming of rice and fish in Liaoning Province.

1. Technical route

In this experiment, the comprehensive income of rice fields is improved by increasing the income of river crabs without reducing rice production. The experiment adopts a mixed culture model of adult crabs and antler crabs in rice fields. The rice field area is 100 mu, of which 80 mu is for adult crabs and 20 mu is for antler crabs. For antler crab farming, high-quality crab seedlings "Photosynthesis No. 1" are selected, and the adult crabs adopt the model of 80% female crabs + 20% male crabs to improve the economic benefits of rice-crab farming. The conventional model is to raise adult crabs in rice fields, with female crabs and male crabs each accounting for half. Compared with the conventional model, the new model has increased income partly from the value of antler crabs being higher than the output of adult crabs, and the other part from the value of female crabs being higher than the selling price of male crabs.

Expand remaining 82%

Do you support disbanding the men's football team?

123,000 people expressed their opinions

406 views

Not supported

support

Specializes in World Cup football sports events, watch online for free!

advertise

Recommended Reading

Why do women like men to come from behind? Answer: Because it is very happy and comfortable!

Passionate kiss 8 hours ago 151,000+

The easiest way to reduce fever

Bai Qian's Pillow Book Yesterday 20:37 11,000

I realized after 7 days of impotence that the high fever is not dangerous, but the symptoms in the next week are dangerous

Niupi 2 Entertainment 19:15 the day before yesterday 1.448 million+

From now on, I will go back to the past, devote myself to each other, make each other happy, reconcile, and live the rest of my life with my old love

Kakuzu Yong Maternity and Baby Care 2022.12.04 532

What does the rural saying "Don't send cigarettes to a birthday party, don't send cigarettes to a funeral party" mean? Our ancestors were particular about

10 History Yesterday 10:00 595

Why can't women forget men who have had "physical contact"? Women give these reasons

Xiyang Xikan Entertainment... 27 minutes ago 5

Why do women like men to hug them from behind? It's simple, men need to understand these three psychological

Xixin Entertainment 27 minutes ago 203

Congratulations to the women's volleyball team! 27-year-old Zhang Chang